Molecular Basis of Inheritance

174 questions · Biology · NEET

Molecular Basis of Inheritance

174 questions · Biology · NEET

Match List-I with List-II Choose the correct answer from the options given below: Includes table2025 · Q14 · MCQ
Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5' end of hnRNA. D.…2025 · Q17 · MCQ
Given below are two statements: Statement I: In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical…2025 · Q34 · MCQ
Given below are two statements : Statement 1 : Transfer RNAs and ribosomal RNA do not interact with mRNA. Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence. In the light of the…2025 · Q35 · MCQ
Who proposed that the genetic code for amino acids should be made up of three nucleotides?2025 · Q68 · MCQ
Which factor is important for termination of transcription?2025 · Q72 · MCQ
Which chromosome in the human genome has the highest number of genes?2025 · Q8 · MCQ
The lactose present in the growth medium of bacteria is transported to the cell by the action of2024 · Q12 · MCQ
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;2024 · Q32 · MCQ
Which of the following statement is correct regarding the process of replication in E.coli?2024 · Q39 · MCQ
Match List I with List II Choose the correct answer from the options given below: Includes table2024 · Q48 · MCQ
Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · Q63 · MCQ
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · Q69 · MCQ
Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · Q96 · MCQ
Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · Q15 · MCQ
Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have…2024 · Q26 · MCQ
In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:2024 · Q3 · MCQ
Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose…2024 · Q36 · MCQ
Given below are two statements : Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense. Statement II : RNAi involves the silencing of a specific mRNA due to a complementary single-stranded RNA…2024 · Q88 · MCQ
The last chromosome sequenced in Human Genome Project was:2023 · Q16 · MCQ
Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.2023 · Q23 · MCQ
Given below are two statements : Statement I : The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Statement II : A transcription unit in DNA is defined primarily by the three regions…2023 · Q38 · MCQ
Which scientist conducted an experiment with 32P and 35S labelled phages for demonstrating that DNA is the genetic material?2023 · Q39 · MCQ
Given below are two statements : Statement I : RNA being unstable, mutate at a faster rate. Statement II : RNA can directly code for synthesis of proteins hence can easily express the characters. In the light of the above statements,…2023 · Q50 · MCQ
Select the correct statements about sickle cell anaemia. (A) There is a change in gene for beta globin. (B) In the beta globin, there is valine in the place of Lysine. (C) It is an example of point mutation. (D) In the normal gene U is…2023 · Q60 · MCQ
Which one of the following acts as an inducer for lac operon ?2023 · Q68 · MCQ
With reference to Hershey and Chase experiments. Select the correct statements. (A) Viruses grown in the presence of radioactive phosphorus contained radioactive DNA. (B) Viruses grown on radioactive sulphur contained radioactive proteins.…2023 · Q76 · MCQ
The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific (D) The code is nearly universal Choose the most appropriate answer from the options given below…2023 · Q78 · MCQ
Unequivocal proof that DNA is the genetic material was first proposed by2023 · Q16 · MCQ
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?2023 · Q18 · MCQ
Expressed Sequence Tags (ESTs) refers to2023 · Q24 · MCQ
Upon exposure to UV radiation, DNA stained with ethidium bromide will show2023 · Q25 · MCQ
Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · Q57 · MCQ
Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · Q70 · MCQ
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · Q80 · MCQ
Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · Q23 · MCQ
Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · Q26 · MCQ
Match List-I with List-II: Choose the correct answer from the options given below: Includes table2022 · Q35 · MCQ
In lac operon, z gene codes for2022 · Q5 · MCQ
Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?2022 · Q83 · MCQ
If A and C make 30% and 20% of DNA, respectively, what will be the percentage composition of T and G?2022 · Q92 · MCQ
DNA polymorphism forms the basis of:2022 · Q15 · MCQ
Read the following statements and choose the set of correct statements: (a) Euchromatin is loosely packed chromatin (b) Heterochromatin is transcriptionally active (c) Histone octamer is wrapped by negatively charged DNA in nucleosome (d)…2022 · Q21 · MCQ
Transposons can be used during which one of the following?2022 · Q32 · MCQ
If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called as :2022 · Q42 · MCQ
If the length of a DNA molecule is 1.1 metres, what will b the approximate number of base pairs?2022 · Q47 · MCQ
In an E. Coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?2022 · Q58 · MCQ
The process of translation of mRNA to proteins begins as soon as:2022 · Q7 · MCQ
Ten E.coli cells with 15N - dsDNA are incubated in medium containing 14N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from 15N?2022 · Q80 · MCQ
DNA strands on a gel stained with ethidium bromide when viewed under UV radiation, appear as2021 · Q10 · MCQ
Complete the flow chart on central dogma. Includes diagram2021 · Q23 · MCQ
What is the role of RNA polymerase III in the process of transcription in eukaryotes?2021 · Q38 · MCQ
DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as2021 · Q41 · MCQ
Identify the correct statement.2021 · Q44 · MCQ
If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?2021 · Q52 · MCQ
Which of the following RNAs is not required for the synthesis of protein?2021 · Q71 · MCQ
Which is the "Only enzyme" that has "Capability" to catalyse Initiation, Elongation and Termination in the process of transcription in prokaryotes?2021 · Q75 · MCQ
Which one of the following statements about histones is wrong?2021 · Q87 · MCQ
Statement I : The codon 'AUG' codes for methionine and phenylalanine. Statement II : 'AAA' and 'AAG' both codons code for the amino acid lysine. In the light of the above statements, choose the correct answer from the options given below.2021 · Q88 · MCQ
If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 109 bp, then the length of the DNA is approximately2020 · Q48 · MCQ
Which of the following statements is correct?2020 · Q49 · MCQ
The first phase of translation is2020 · Q50 · MCQ
Name the enzyme that facilitates opening of DNA helix during transcription.2020 · Q78 · MCQ
Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?2019 · Q10 · MCQ
The shorter and longer arms of a submetacentric chromosome are referred to as:2019 · Q11 · MCQ
Purines found both in DNA and RNA are:2019 · Q6 · MCQ
Expressed Sequence Tags (ESTs) refers to :2019 · Q7 · MCQ
Match the following genes of the Lac operon with their respective produces : Select the correct option. Includes table2019 · Q8 · MCQ
Under which of the following conditions will there be no change in the reading frame of following mRNA? 5' AACAGCGGUGCUAUU 3'2019 · Q9 · MCQ
Select the correct match :2018 · Q71 · MCQ
The experimental proof for semi-conservative replication of DNA was first shown in a2018 · Q73 · MCQ
Select the correct statement :2018 · Q74 · MCQ
Select the correct match :2018 · Q75 · MCQ
Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as2018 · Q76 · MCQ
All of the following are part of an operon except2018 · Q77 · MCQ
AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?2018 · Q78 · MCQ
During DNA replication, Okazaki fragments are used to elongate2017 · Q64 · MCQ
If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered ?2017 · Q73 · MCQ
The final proof for DNA as the genetic material came from the experiments of2017 · Q74 · MCQ
Which of the following RNAs should be most abundant in animal cell ?2017 · Q76 · MCQ
Spliceosomes are not found in cells of :2017 · Q77 · MCQ
The association of histone H1 with a nucleosome indicates :2017 · Q78 · MCQ
Which one of the following is the starter codon ?2016 · Q63 · MCQ
Which of the following is required as inducer(s) for the expression of Lac operon?2016 · Q75 · MCQ
A complex of ribosomes attached to a single strand of RNA is known as :2016 · Q76 · MCQ
DNA-dependent RNA polymerase catalyzes transcription on one strand of the DNA which is called the2016 · Q60 · MCQ
Taylor conducted the experiments to prove semiconservative mode of chromosome replication on2016 · Q67 · MCQ
The equivalent of a structural gene is -2016 · Q68 · MCQ
A molecule that can act as a genetic material must fulfill the traits given below, except2016 · Q69 · MCQ
Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria ?2016 · Q70 · MCQ
Identify the correct order of organisation of genetic material from largest to smallest :2015 · Q51 · MCQ
Which one of the following is not applicable to RNA?2015 · Q60 · MCQ
Balbiani rings are sites of :2015 · Q61 · MCQ
Satellite DNA is important because it :2015 · Q62 · MCQ
Gene regulation governing lactose operon of E.coli that involves the lac I gene product is2015 · Q60 · MCQ
In sea urchin DNA, which is double stranded, 17% of the bases were shown to be cytosine, The percentages of the other three bases expected to be present in this DNA are2015 · Q61 · MCQ
Transformation was discovered by :2014 · Q70 · MCQ
Which one of the following is wrongly matched?2014 · Q71 · Multiple correct
Select the correct option ;2014 · Q72 · MCQ
The figure gives an important concept in the genetic implication of DNA . Fill the blanks A, B and C. Includes diagram2013 · Q19 · MCQ
Satellite RNA are present in some :2013 · Q20 · MCQ
Which of the following is not a property of the genetic code ?2013 · Q32 · MCQ
Genes of interest can be selected from a genomic library by using :2013 · Q61 · MCQ
One of the most frequently used techniques in DNA fingerprinting is :-2013 · Q62 · MCQ
In an inducible operon, the genes are :2013 · Q63 · MCQ
The diagram shows an important concept in the genetic implication of DNA. Fill in the blanks A to C. Includes diagram2013 · Q68 · MCQ
Which enzyme will be produced in a cell in which there is a non-sense mutation in the lac Y gene ?2013 · Q69 · MCQ
Which of the following statements is not true of two genes that show 50% recombination frequency ?2013 · Q70 · MCQ
If one strand of DNA has the nitrogenous base sequence as ATCTG, what would be the complementary RNA stand sequence2012 · Q71 · MCQ
Removal of introns and joining of exons in a defined order during transcription is called2012 · Q72 · MCQ
Which one of the following is not a part of a transcription unit in DNA ?2012 · Q73 · MCQ
Ribosomal RNA is actively synthesized in2012 · Q74 · MCQ
Removal of RNA polymerase -III from nucleoplasm will affect the synthesis of2012 · Q75 · MCQ
The unequivocal proof of DNA as the genetic material came from the studies on a :2011 · Q4 · MCQ
What are those structures that appear as 'beads-on-string' in the chromosomes when viewed under electron microscope ?2011 · Q67 · MCQ
Which one of the follwoing statements about the particular entity is true ?2010 · Q44 · MCQ
In eukaryotic cell transcription, RNA splicing and RNA capping take place inside the -2010 · Q45 · MCQ
The lac Operon consists of -2010 · Q46 · MCQ
The 3'-5' phosphodiester linkages inside a polynucleotide chain serve to join -2010 · Q47 · MCQ
Select the two correct statements out of the four (a-d) statements given below about lac operon. (a) Glucose or galactose may bind with the repressor and inactivate it (b) In the absence of lactose the repressor binds with the operator…2010 · Q69 · MCQ
Which one of the following does not follow the central dogma of molecular biology ?2010 · Q79 · MCQ
Which one of the following palindromic base sequences in DNA can be easily cut at about the middle by some particular restriction enzyme?2010 · Q80 · MCQ
The one aspect which is not a salient feature of genetic code, is its being –2010 · Q81 · MCQ
Semi-conservative replication of DNA was first demonstrated in :2009 · Q72 · MCQ
Whose experiments cracked the DNA and discovered unequivocally that a genetic code is a "triplet" ?2009 · Q73 · MCQ
Removal of introns and joining the exons in a defined order in a transcription unit is called :2009 · Q74 · MCQ
What is not true for genetic code?2009 · Q75 · MCQ
In the DNA molecule:2008 · Q70 · MCQ
Which one of the following pairs of nitrogenous bases of nucleic acids, is wrongly matched with the category mentioned against it?2008 · Q71 · MCQ
Which one of the following pairs of codons is correctly matched with their function or the signal for the particular amino acid ?2008 · Q72 · MCQ
Polysome is formed by2008 · Q73 · MCQ
One gene-one enzyme hypothesis was postulated by -2006 · Q61 · MCQ
One turn of the helix in a B-form DNA is approximately -2006 · Q72 · MCQ
Antiparallel strands of a DNA molecule means that-2006 · Q73 · MCQ
Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis ?2006 · Q74 · MCQ
Amino acid sequence, in protein synthesis is decided by the sequence of -2006 · Q75 · MCQ
E. coli cells with a mustard z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because -2005 · Q67 · MCQ
Telomerase is an enzyme which is a -2005 · Q68 · MCQ
Using imprints from a plate with complete medium and carrying bacterial colonies, you can select streptomycin resistant mutants and prove that such mutations do not originates as adaptation. These imprints need to be used -2005 · Q69 · MCQ
Which one of the following hydrolyses internal phosphodiester bonds in a polynucleotide chain ?2005 · Q70 · MCQ
Protein synthesis in an animal cell occurs -2005 · Q71 · MCQ
Which one of the following makes use of RNA as a template to synthesize DNA -2005 · Q72 · MCQ
During transcription holoenzyme RNA polymerase binds to a DNA sequence and the DNA assumes a saddle like structure at the point. What is the sequence called ?2005 · Q73 · MCQ
In a mutational event, when adenine is replaced by guanine, it is a case of -2004 · Q57 · MCQ
During transcription, if the nucleotide sequence of the DNA strand that is being coded is ATACG, then the nucleotide sequence in the mRNA would be -2004 · Q65 · MCQ
Which form of RNA has a structure resembling clover leaf ?2004 · Q66 · MCQ
After a mutation at a genetic locus the character of an organism changes due to the change in :-2004 · Q67 · MCQ
The following ratio is generally constant for a given species :-2004 · Q68 · MCQ
What does "lac" refer to in what we call the lac operon ?2003 · Q64 · MCQ
During transcription, the DNA site at which RNA polymerase binds is called :-2003 · Q74 · MCQ
In the genetic code dictionary, how many codons are used to code for all the 20 essential amino acids : -2003 · Q75 · MCQ
During translation initiation in prokaryotes, a GTP molecule is needed in : -2003 · Q76 · MCQ
What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA ?2003 · Q77 · MCQ
Which one of the following triplet codes, is correctly matched with its specificity for an amino acid in protein synthesis or as 'start' or 'stop' codon ?2003 · Q78 · MCQ
Degeneration of a genetic code is attributed to the : -2003 · Q79 · MCQ
Which of the following reunites the exon segments after RNA splicing ?2002 · Q64 · MCQ
In a DNA percentage of thymine is 20% then what is the percentage of guanine : -2002 · Q70 · MCQ
Jacob and Monad studied lactose metabolism in E.Coli and proposed operon concept. Operon concept applicable for :2002 · Q71 · MCQ
Transformation experiment was first performed on which bacteria : -2002 · Q72 · MCQ
In E. Coli, during lactose metabolism repressor binds to : -2002 · Q73 · MCQ
Exon part of m-RNAs have code for : -2002 · Q74 · MCQ
Which of the following enzymes are used to join bits of DNA ?2002 · Q75 · MCQ
Out of 64 codons, 61 codons code for 20 types of amino acid it is called : -2002 · Q76 · MCQ
Change in sequence of nucleotide in DNA is called as -2002 · Q77 · MCQ
Types of RNA polymerase required in nucleus for RNA synthesis : -2001 · Q57 · MCQ
In Negative operon : -2001 · Q66 · MCQ
m-RNA is synthesised on DNA template in which direction : -2001 · Q67 · MCQ
Gene and cistron words are sometimes used synonymously because : -2001 · Q68 · MCQ
Which of the following is initiation codon ?2000 · Q71 · MCQ
Method of DNA replication in which two strands of DNA separates and synthesize new strands2000 · Q72 · MCQ
Anticodon occurs in :2000 · Q73 · MCQ
Length of one loop of B- DNA :2000 · Q74 · MCQ
In three dimensional view the molecule of t-RNA is :2000 · Q75 · MCQ
Similarity in DNA and RNA :2000 · Q76 · MCQ