Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2025 · Q8
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2025 · Q8

Molecular Basis of Inheritance question

2025 · Q8

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Which chromosome in the human genome has the highest number of genes?

  1. A
    Chromosome 1
  2. B
    Chromosome 10
  3. C
    Chromosome X
  4. D
    Chromosome Y
View written solutionFree

Correct answer: A

In human genome, Chromosome 1 has the highest number of genes, i.e., 2968.

PreviousNext

More from Molecular Basis of Inheritance

  • The lactose present in the growth medium of bacteria is transported to the cell by the action of2024 · MCQ
  • A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;2024 · MCQ
  • Which of the following statement is correct regarding the process of replication in E.coli?2024 · MCQ
  • Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
  • Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
  • Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · MCQ