NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
Which chromosome in the human genome has the highest number of genes?
- AChromosome 1
- BChromosome 10
- CChromosome X
- DChromosome Y
View written solutionFree
Correct answer: A
In human genome, Chromosome 1 has the highest number of genes, i.e., 2968.
More from Molecular Basis of Inheritance
- The lactose present in the growth medium of bacteria is transported to the cell by the action of2024 · MCQ
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;2024 · MCQ
- Which of the following statement is correct regarding the process of replication in E.coli?2024 · MCQ
- Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
- Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
- Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ
- Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · MCQ