Doubts
Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents
Sign in to save progress →
Doubts
Sign in

Molecular Basis of Inheritance question

2024 · Q39
Guest · try one question or challengeGuest · try one question or challenge
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2024 · Q39

Molecular Basis of Inheritance question

2024 · Q39

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Which of the following statement is correct regarding the process of replication in E.coli?

  1. A
    'The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3′→53^{\prime} \rightarrow 53′→5'

  2. B
    The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5′→3′5^{\prime} \rightarrow 3^{\prime}5′→3′
  3. C
    The DNA dependent DNA polymerase catalyses polymerization in 5' →\rightarrow→ 3' as well as 3′→5′3^{\prime} \rightarrow 5^{\prime}3′→5′ direction
  4. D
    The DNA dependent DNA polymerase catalyses polymerization in 5' →\rightarrow→ 3' direction
PreviousNext

More from Molecular Basis of Inheritance

  • Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
  • Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
  • Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · MCQ
  • Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have…2024 · MCQ
  • In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:2024 · MCQ
  • Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose…2024 · MCQ