Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2024 · Q39
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2024 · Q39

Molecular Basis of Inheritance question

2024 · Q39

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Which of the following statement is correct regarding the process of replication in E.coli?

  1. A
    'The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3′→53^{\prime} \rightarrow 53′→5'

  2. B
    The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5′→3′5^{\prime} \rightarrow 3^{\prime}5′→3′
  3. C
    The DNA dependent DNA polymerase catalyses polymerization in 5' →\rightarrow→ 3' as well as 3′→5′3^{\prime} \rightarrow 5^{\prime}3′→5′ direction
  4. D
    The DNA dependent DNA polymerase catalyses polymerization in 5' →\rightarrow→ 3' direction
View written solutionFree

Correct answer: D

The correct statement regarding the process of replication in E.coli is found in Option D: "The DNA dependent DNA polymerase catalyses polymerization in 5' $\rightarrow$ 3' direction".

To elaborate, replication in E.coli involves the synthesis of new DNA strands from a DNA template. This synthesis is catalyzed by an enzyme known as DNA polymerase. DNA polymerases are key enzymes that add nucleotides to the growing DNA strand during replication. However, the key characteristic of these enzymes is their directionality. DNA polymerases can only add nucleotides to the 3' end of the DNA strand, thereby synthesizing new DNA in the direction of 5' $\rightarrow$ 3'.

This directional limitation is due to the structure of deoxyribonucleotide triphosphates (dNTPs) that are used as substrates by the enzyme. Each dNTP has a 5' phosphate group, a 3' hydroxyl group, and a nitrogenous base. The formation of DNA strands occurs via the formation of phosphodiester bonds between the 3' hydroxyl group of one nucleotide and the phosphate group at the 5' position of the next nucleotide. Therefore, nucleotides can only be added to the 3' end of the growing strand.

The other options are incorrect for the following reasons:

  • Option A incorrectly states the direction of synthesis as $$3^{\prime} \rightarrow 5^{\prime}$$, which is impossible with the mechanics of DNA polymerases.
  • Option B refers to DNA dependent RNA polymerase. This enzyme is indeed involved in transcription (synthesizing RNA from DNA), not replication, and synthesizes RNA in the $$5^{\prime} \rightarrow 3^{\prime}$$ direction.
  • Option C incorrectly states that DNA polymerase can synthesize in both directions, which contradicts the inherent directional nature of this enzyme.

Therefore, understanding the precise enzyme mechanics and functionality helps in recognizing that Option D is the correct description of how DNA dependent DNA polymerase facilitates DNA replication in E.coli.

PreviousNext

More from Molecular Basis of Inheritance

  • Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
  • Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
  • Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · MCQ
  • Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have…2024 · MCQ
  • In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:2024 · MCQ
  • Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose…2024 · MCQ