NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
- ABoth Statement I and Statement II are false.
- BStatement I is correct but Statement II is false.
- CStatement I is incorrect but Statement II is true.
- DBoth Statement I and Statement II are true.
More from Molecular Basis of Inheritance
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
- Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ
- Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · MCQ
- Match List-I with List-II: Choose the correct answer from the options given below: Includes table2022 · MCQ
- In lac operon, z gene codes for2022 · MCQ
- Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?2022 · MCQ
- If A and C make 30% and 20% of DNA, respectively, what will be the percentage composition of T and G?2022 · MCQ
- DNA polymorphism forms the basis of:2022 · MCQ