Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2023 · Q70
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2023 · Q70

Molecular Basis of Inheritance question

2023 · Q70

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Given below are two statements:

Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.

Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.

In the light of the above statements, choose the correct answer from the options given below:

  1. A
    Both Statement I and Statement II are false.
  2. B
    Statement I is correct but Statement II is false.
  3. C
    Statement I is incorrect but Statement II is true.
  4. D
    Both Statement I and Statement II are true.
View written solutionFree

Correct answer: C

In prokaryotes, the negatively charged DNA is held with some positively charged proteins in a region termed as nucleoid.

In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form a structure called nucleosome.

PreviousNext

More from Molecular Basis of Inheritance

  • Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
  • Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ
  • Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · MCQ
  • Match List-I with List-II: Choose the correct answer from the options given below: Includes table2022 · MCQ
  • In lac operon, z gene codes for2022 · MCQ
  • Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?2022 · MCQ
  • If A and C make 30% and 20% of DNA, respectively, what will be the percentage composition of T and G?2022 · MCQ
  • DNA polymorphism forms the basis of:2022 · MCQ