NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
With reference to Hershey and Chase experiments. Select the correct statements.
(A) Viruses grown in the presence of radioactive phosphorus contained radioactive DNA.
(B) Viruses grown on radioactive sulphur contained radioactive proteins.
(C) Viruses grown on radioactive phosphorus contained radioactive protein.
(D) Viruses grown on radioactive sulphur contained radioactive DNA.
(E) Viruses grown on radioactive protein contained radioactive DNA.
Choose the most appropriate answer from the options given below :
- A(D) and (E) only
- B(A) and (B) only
- C(A) and (C) only
- D(B) and (D) only
More from Molecular Basis of Inheritance
- The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific (D) The code is nearly universal Choose the most appropriate answer from the options given below…2023 · MCQ
- Unequivocal proof that DNA is the genetic material was first proposed by2023 · MCQ
- What is the role of RNA polymerase III in the process of transcription in Eukaryotes?2023 · MCQ
- Expressed Sequence Tags (ESTs) refers to2023 · MCQ
- Upon exposure to UV radiation, DNA stained with ethidium bromide will show2023 · MCQ
- Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · MCQ
- Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ