Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2023 · Q76
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2023 · Q76

Molecular Basis of Inheritance question

2023 · Q76

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

With reference to Hershey and Chase experiments. Select the correct statements.

(A) Viruses grown in the presence of radioactive phosphorus contained radioactive DNA.

(B) Viruses grown on radioactive sulphur contained radioactive proteins.

(C) Viruses grown on radioactive phosphorus contained radioactive protein.

(D) Viruses grown on radioactive sulphur contained radioactive DNA.

(E) Viruses grown on radioactive protein contained radioactive DNA.

Choose the most appropriate answer from the options given below :

  1. A
    (D) and (E) only
  2. B
    (A) and (B) only
  3. C
    (A) and (C) only
  4. D
    (B) and (D) only
View written solutionFree

Correct answer: B

Option B : (A) and (B) only

Explanation : In the Hershey and Chase experiments, they used bacteriophages (viruses that infect bacteria) and grew one batch in the presence of radioactive phosphorus (P32) and another batch in the presence of radioactive sulfur (S35).

Phosphorus is a component of DNA but not of protein. Therefore, any virus particles grown in the presence of radioactive phosphorus would have radioactive DNA, which is statement (A).

Sulfur is found in proteins (in the amino acids methionine and cysteine) but not in DNA. Therefore, any virus particles grown in the presence of radioactive sulfur would have radioactive protein, which is statement (B).

Statements (C), (D), and (E) are incorrect because they do not align with the components of DNA and proteins, and where sulfur and phosphorus are found in these molecules.

The Hershey and Chase experiments were key in establishing that DNA, not protein, is the genetic material. When these radioactive viruses infected bacteria, they found that the radioactive DNA (from phosphorus) was transferred to the bacteria, not the radioactive protein (from sulfur).

PreviousNext

More from Molecular Basis of Inheritance

  • The salient features of genetic code are : (A) The code is palindromic (B) UGA act as initiator codon (C) The code is unambiguous and specific (D) The code is nearly universal Choose the most appropriate answer from the options given below…2023 · MCQ
  • Unequivocal proof that DNA is the genetic material was first proposed by2023 · MCQ
  • What is the role of RNA polymerase III in the process of transcription in Eukaryotes?2023 · MCQ
  • Expressed Sequence Tags (ESTs) refers to2023 · MCQ
  • Upon exposure to UV radiation, DNA stained with ethidium bromide will show2023 · MCQ
  • Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · MCQ
  • Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
  • Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ