DNA-dependent RNA polymerase is an enzyme responsible for transcribing DNA into RNA. During transcription, the RNA polymerase reads the template strand of DNA and synthesizes a complementary RNA strand. A key point in this process is that RNA polymerase builds RNA by replacing thymine (T) with uracil (U).

The provided DNA template is:

3'TACATGGCAAATATCCATTCA5'

To find the correct RNA sequence, we need to identify the complementary base for each base in the template strand while considering RNA bases. Remember, in RNA:

• A (Adenine) pairs with U (Uracil)
• T (Thymine) pairs with A (Adenine)
• C (Cytosine) pairs with G (Guanine)
• G (Guanine) pairs with C (Cytosine)

The complementary RNA sequence to the DNA template is generated as follows:

• 3'T --> 5'A
• 3'A --> 5'U
• 3'C --> 5'G
• 3'G --> 5'C
• 3'T --> 5'A
• 3'A --> 5'U
• 3'T --> 5'A
• 3'G --> 5'C
• 3'G --> 5'C
• 3'C --> 5'G
• 3'A --> 5'U
• 3'A --> 5'U
• 3'T --> 5'A
• 3'A --> 5'U
• 3'T --> 5'A
• 3'C --> 5'G
• 3'C --> 5'G
• 3'A --> 5'U
• 3'T --> 5'A
• 3'T --> 5'A
• 3'C --> 5'G'

This constructs the RNA sequence:

5'AUGUACCGUUUAUAGGUAAGU3'

Thus, Option A correctly represents the RNA sequence transcribed by DNA-dependent RNA polymerase from the given DNA template:

Option A: 5'AUGUACCGUUUAUAGGUAAGU3'