NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
- A5'AUGUACCGUUUAUAGGUAAGU3'
- B5'AUGUAAAGUUUAUAGGUAAGU3'
- C5'AUGUACCGUUUAUAGGGAAGU3'
- D5'ATGTACCGTTTATAGGTAAGT3'
More from Molecular Basis of Inheritance
- Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ
- Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · MCQ
- Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have…2024 · MCQ
- In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:2024 · MCQ
- Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose…2024 · MCQ
- Given below are two statements : Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense. Statement II : RNAi involves the silencing of a specific mRNA due to a complementary single-stranded RNA…2024 · MCQ
- The last chromosome sequenced in Human Genome Project was:2023 · MCQ
- Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.2023 · MCQ