Doubts
Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents
Sign in to save progress →
Doubts
Sign in

Molecular Basis of Inheritance question

2025 · Q72
Guest · try one question or challengeGuest · try one question or challenge
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2025 · Q72

Molecular Basis of Inheritance question

2025 · Q72

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Which factor is important for termination of transcription?

  1. A
    ρ\rhoρ (rho)
  2. B
    γ\gammaγ (gamma)
  3. C
    α\alphaα (alpha)
  4. D
    σ\sigmaσ (sigma)
PreviousNext

More from Molecular Basis of Inheritance

  • Which chromosome in the human genome has the highest number of genes?2025 · MCQ
  • The lactose present in the growth medium of bacteria is transported to the cell by the action of2024 · MCQ
  • A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;2024 · MCQ
  • Which of the following statement is correct regarding the process of replication in E.coli?2024 · MCQ
  • Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
  • Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
  • Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ