Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2025 · Q72
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2025 · Q72

Molecular Basis of Inheritance question

2025 · Q72

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Which factor is important for termination of transcription?

  1. A
    ρ\rhoρ (rho)
  2. B
    γ\gammaγ (gamma)
  3. C
    α\alphaα (alpha)
  4. D
    σ\sigmaσ (sigma)
View written solutionFree

Correct answer: A

The key player in prokaryotic transcription termination is the ρ (rho) factor.

• ρ–dependent termination

– Rho is an RNA-helicase that binds a rut site on the nascent mRNA.

– It moves along the transcript, catches up with RNA polymerase and unwinds the RNA–DNA hybrid, releasing the mRNA.

By contrast:

• σ (sigma) is needed for initiation, not termination.

• α and γ are subunits of RNA polymerase (α for assembly/stability, γ isn’t a termination factor).

Answer: Option A (ρ)

PreviousNext

More from Molecular Basis of Inheritance

  • Which chromosome in the human genome has the highest number of genes?2025 · MCQ
  • The lactose present in the growth medium of bacteria is transported to the cell by the action of2024 · MCQ
  • A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;2024 · MCQ
  • Which of the following statement is correct regarding the process of replication in E.coli?2024 · MCQ
  • Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
  • Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
  • Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ