NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
Which factor is important for termination of transcription?
- A(rho)
- B(gamma)
- C(alpha)
- D(sigma)
View written solutionFree
Correct answer: A
The key player in prokaryotic transcription termination is the ρ (rho) factor.
• ρ–dependent termination
– Rho is an RNA-helicase that binds a rut site on the nascent mRNA.
– It moves along the transcript, catches up with RNA polymerase and unwinds the RNA–DNA hybrid, releasing the mRNA.
By contrast:
• σ (sigma) is needed for initiation, not termination.
• α and γ are subunits of RNA polymerase (α for assembly/stability, γ isn’t a termination factor).
Answer: Option A (ρ)
More from Molecular Basis of Inheritance
- Which chromosome in the human genome has the highest number of genes?2025 · MCQ
- The lactose present in the growth medium of bacteria is transported to the cell by the action of2024 · MCQ
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;2024 · MCQ
- Which of the following statement is correct regarding the process of replication in E.coli?2024 · MCQ
- Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
- Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
- Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ