NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
Match List I with List II :
| List - I | List - II | ||
|---|---|---|---|
| A. | Down's syndrome | I. | 11 chromosome |
| B. | -thalassemia | II. | 'X' chromosome |
| C. | -thalassemia | III. | 21 chromosome |
| D. | Klinefelter's syndrome | IV. | 16 chromosome |
Choose the correct answer from the options given below :
- AA-I, B-II, C-III, D-IV
- BA-II, B-III, C-IV, D-I
- CA-III, B-IV, C-I, D-II
- DA-IV, B-I, C-II, D-III
View written solutionFree
Correct answer: C
To correctly match List I with List II concerning medical conditions and their associated chromosomes, it's essential to have some understanding of genetics and chromosome abnormalities related with each condition. Here's the correct matching based on that information:
- Down's syndrome: This genetic disorder is characterized by an extra copy (trisomy) of the 21$^\mathrm{st}$ chromosome, which makes it associated with 21$^\mathrm{st}$ chromosome (III).
- $\alpha$-thalassemia: This condition is related to a mutation or deletion in the alpha globin genes located on the 16$^\mathrm{th}$ chromosome (IV).
- $\beta$-thalassemia: This is a blood disorder caused due to mutations in the beta globin gene found on the 11$^\mathrm{th}$ chromosome (I).
- Klinefelter's syndrome: This syndrome arises from the presence of an extra X chromosome in males (usually XXY), so it is related to abnormality in the 'X' chromosome (II).
Given these matches:
- A - III
- B - IV
- C - I
- D - II
The correct option based on the details above is:
Option C: A-III, B-IV, C-I, D-II
More from Molecular Basis of Inheritance
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
- Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ
- Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · MCQ
- Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have…2024 · MCQ
- In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:2024 · MCQ
- Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose…2024 · MCQ
- Given below are two statements : Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense. Statement II : RNAi involves the silencing of a specific mRNA due to a complementary single-stranded RNA…2024 · MCQ
- The last chromosome sequenced in Human Genome Project was:2023 · MCQ