Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2024 · Q32
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2024 · Q32

Molecular Basis of Inheritance question

2024 · Q32

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

  1. A
    Repressor, Operator gene, Structural gene
  2. B
    Structural gene, Transposons, Operator gene
  3. C
    Inducer, Repressor, Structural gene
  4. D
    Promotor, Structural gene, Terminator
View written solutionFree

Correct answer: D

A transcription unit in DNA is critical for the process of transcription, wherein a particular segment of DNA is copied into RNA (especially mRNA) by the enzyme RNA polymerase. This unit is composed of sequences that include both coding regions, which are directly transcribed into RNA, and regulatory regions, which ensure that transcription is initiated and terminated at the correct locations on the DNA.

The correct answer is:

Option D: Promotor, Structural gene, Terminator

Here's a detailed explanation of each component:

  • Promoter: The promoter is a sequence in DNA that signals the RNA polymerase to start transcription. It is located at the upstream end (5' end) of the gene. Promoters are essential for transcription initiation and are typically found just before the genes they regulate.
  • Structural gene: This region of the transcription unit is actually expressed or translated into protein (or functional RNA), depending on the kind of gene. These genes contain the functional sequences that are copied during the transcription process.
  • Terminator: The terminator is found at the downstream end (3' end) of the transcription unit and includes sequences that signal the RNA polymerase enzyme to stop transcription. This ensures that the newly synthesized RNA contains only the necessary genetic message.

The other options contain components that do not accurately define the typical structure of a transcription unit:

  • Option A mixes regulatory proteins and DNA regions, which does not accurately represent the structural components of a transcription unit.
  • Option B includes "transposons" which are genetic elements that can move around within the genomes but are not typically part of the transcription unit.
  • Option C again refers to regulatory proteins (inducer and repressor) along with structural genes, confusing the functions of proteins and DNA regions.

Therefore, Option D correctly represents the standard components of a transcription unit in the context of gene transcription in DNA.

PreviousNext

More from Molecular Basis of Inheritance

  • Which of the following statement is correct regarding the process of replication in E.coli?2024 · MCQ
  • Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
  • Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
  • Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · MCQ
  • Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have…2024 · MCQ
  • In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:2024 · MCQ