NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
- ATranscription of tRNA, 5S rRNA and snRNA
- BTranscription of precursor of mRNA
- CTranscription of only snRNAs
- DTranscription of rRNAs (28S, 18S and 5.8S)
View written solutionFree
Correct answer: A
In eukaryotes there are three major types of RNA polymerases.
RNA polymerase I transcribes : 5.8S, 18S, 28S rRNAs
RNA polymerase II transcribes : hnRNAs (precurssor of mRNA)
RNA polymerase III transcribes : tRNAs, ScRNA, 5S rRNA and snRNA
More from Molecular Basis of Inheritance
- Expressed Sequence Tags (ESTs) refers to2023 · MCQ
- Upon exposure to UV radiation, DNA stained with ethidium bromide will show2023 · MCQ
- Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · MCQ
- Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
- Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ
- Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · MCQ
- Match List-I with List-II: Choose the correct answer from the options given below: Includes table2022 · MCQ