Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2023 · Q18
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2023 · Q18

Molecular Basis of Inheritance question

2023 · Q18

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

  1. A
    Transcription of tRNA, 5S rRNA and snRNA
  2. B
    Transcription of precursor of mRNA
  3. C
    Transcription of only snRNAs
  4. D
    Transcription of rRNAs (28S, 18S and 5.8S)
View written solutionFree

Correct answer: A

In eukaryotes there are three major types of RNA polymerases.

RNA polymerase I transcribes : 5.8S, 18S, 28S rRNAs

RNA polymerase II transcribes : hnRNAs (precurssor of mRNA)

RNA polymerase III transcribes : tRNAs, ScRNA, 5S rRNA and snRNA

PreviousNext

More from Molecular Basis of Inheritance

  • Expressed Sequence Tags (ESTs) refers to2023 · MCQ
  • Upon exposure to UV radiation, DNA stained with ethidium bromide will show2023 · MCQ
  • Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · MCQ
  • Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
  • Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
  • Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ
  • Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · MCQ
  • Match List-I with List-II: Choose the correct answer from the options given below: Includes table2022 · MCQ