Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2024 · Q12
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2024 · Q12

Molecular Basis of Inheritance question

2024 · Q12

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

The lactose present in the growth medium of bacteria is transported to the cell by the action of

  1. A
    Beta-galactosidase
  2. B
    Acetylase
  3. C
    Permease
  4. D
    Polymerase
View written solutionFree

Correct answer: C

The correct answer is Option C: Permease.

Lactose, a disaccharide sugar composed of glucose and galactose, needs particular mechanisms to be transported into bacterial cells for metabolism. Among the options provided, permease is the protein responsible for this function. Specifically, in the case of bacterial cells such as Escherichia coli, the lactose permease enzyme plays a crucial role.

Lactose permease is encoded by the lacY gene, which is part of the lac operon. The lac operon is a famous example of gene regulation in bacteria. When lactose is present outside the cell, lactose permease facilitates its transport into the cell across the cell membrane. Once inside, lactose can be utilized as a source of energy and carbon.

Once lactose is inside the bacterial cell:

  • It is broken down by the enzyme β-galactosidase into glucose and galactose. This enzyme is encoded by the lacZ gene, which is a different component of the lac operon.

We can rule out the other options because:

  • Beta-galactosidase (Option A) is involved in the hydrolysis of lactose into glucose and galactose but not in its transport.
  • Acetylase (Option B) refers to enzymes involved in the addition of acetyl groups to substrates, unrelated to sugar transport.
  • Polymerase (Option D) are enzymes that synthesize RNA and DNA, thus also unrelated to transporting sugars like lactose.

Thus, to facilitate the transport of lactose across the cell membrane into the bacterial cell, lactose permease (Option C) is required, making it the correct choice.

PreviousNext

More from Molecular Basis of Inheritance

  • A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;2024 · MCQ
  • Which of the following statement is correct regarding the process of replication in E.coli?2024 · MCQ
  • Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
  • Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
  • Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · MCQ
  • Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have…2024 · MCQ