Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2023 · Q78
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2023 · Q78

Molecular Basis of Inheritance question

2023 · Q78

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

The salient features of genetic code are :

(A) The code is palindromic

(B) UGA act as initiator codon

(C) The code is unambiguous and specific

(D) The code is nearly universal

Choose the most appropriate answer from the options given below :

  1. A
    (A) and (D) only
  2. B
    (B) and (C) only
  3. C
    (A) and (B) only
  4. D
    (C) and (D) only
View written solutionFree

Correct answer: D

The correct answer is Option D : (C) and (D) only.

The genetic code is unambiguous and specific, meaning each codon specifies only one amino acid. Also, the genetic code is nearly universal as the same codons specify the same amino acids in all organisms with a few minor exceptions. The code is not palindromic, and UGA does not act as an initiator codon; it is a stop codon in most organisms.

PreviousNext

More from Molecular Basis of Inheritance

  • Unequivocal proof that DNA is the genetic material was first proposed by2023 · MCQ
  • What is the role of RNA polymerase III in the process of transcription in Eukaryotes?2023 · MCQ
  • Expressed Sequence Tags (ESTs) refers to2023 · MCQ
  • Upon exposure to UV radiation, DNA stained with ethidium bromide will show2023 · MCQ
  • Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · MCQ
  • Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
  • Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
  • Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ