NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
The salient features of genetic code are :
(A) The code is palindromic
(B) UGA act as initiator codon
(C) The code is unambiguous and specific
(D) The code is nearly universal
Choose the most appropriate answer from the options given below :
- A(A) and (D) only
- B(B) and (C) only
- C(A) and (B) only
- D(C) and (D) only
More from Molecular Basis of Inheritance
- Unequivocal proof that DNA is the genetic material was first proposed by2023 · MCQ
- What is the role of RNA polymerase III in the process of transcription in Eukaryotes?2023 · MCQ
- Expressed Sequence Tags (ESTs) refers to2023 · MCQ
- Upon exposure to UV radiation, DNA stained with ethidium bromide will show2023 · MCQ
- Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · MCQ
- Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
- Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ