NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
Who proposed that the genetic code for amino acids should be made up of three nucleotides?
- AJacque Monod
- BFranklin Stahl
- CGeorge Gamow
- DFrancis Crick
View written solutionFree
Correct answer: C
The idea that each amino acid is specified by a triplet of nucleotides was first proposed by George Gamow (Option C).
More from Molecular Basis of Inheritance
- Which factor is important for termination of transcription?2025 · MCQ
- Which chromosome in the human genome has the highest number of genes?2025 · MCQ
- The lactose present in the growth medium of bacteria is transported to the cell by the action of2024 · MCQ
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;2024 · MCQ
- Which of the following statement is correct regarding the process of replication in E.coli?2024 · MCQ
- Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
- Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ