Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2025 · Q68
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2025 · Q68

Molecular Basis of Inheritance question

2025 · Q68

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

  1. A
    Jacque Monod
  2. B
    Franklin Stahl
  3. C
    George Gamow
  4. D
    Francis Crick
View written solutionFree

Correct answer: C

The idea that each amino acid is specified by a triplet of nucleotides was first proposed by George Gamow (Option C).

PreviousNext

More from Molecular Basis of Inheritance

  • Which factor is important for termination of transcription?2025 · MCQ
  • Which chromosome in the human genome has the highest number of genes?2025 · MCQ
  • The lactose present in the growth medium of bacteria is transported to the cell by the action of2024 · MCQ
  • A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;2024 · MCQ
  • Which of the following statement is correct regarding the process of replication in E.coli?2024 · MCQ
  • Match List I with List II Choose the correct answer from the options given below: Includes table2024 · MCQ
  • Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ