Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2023 · Q16
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2023 · Q16

Molecular Basis of Inheritance question

2023 · Q16

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Unequivocal proof that DNA is the genetic material was first proposed by

  1. A
    Alfred Hershey and Martha Chase
  2. B
    Avery, Macleoid and McCarthy
  3. C
    Wilkins and Franklin
  4. D
    Frederick Griffith
View written solutionFree

Correct answer: A

The first unequivocal proof that DNA is the genetic material came from the experiments conducted by Alfred Hershey and Martha Chase in 1952. They used bacteriophages (viruses that infect bacteria) and radioactively labeled the protein and DNA of the phage separately in two different sets of experiments. They found that it was the DNA, not the protein, of the phage that was injected into the bacteria and carried the genetic information necessary for the production of new phage particles.

Avery, Macleoid and McCarty gave the biochemical characterisation of Transforming Principle.

The transformation experiments by using Pneumococcus was conducted by Frederick Griffith.

Wilkins and Franklin produced X-ray diffraction data of DNA.

So, the correct answer is :

Option A : Alfred Hershey and Martha Chase.

PreviousNext

More from Molecular Basis of Inheritance

  • What is the role of RNA polymerase III in the process of transcription in Eukaryotes?2023 · MCQ
  • Expressed Sequence Tags (ESTs) refers to2023 · MCQ
  • Upon exposure to UV radiation, DNA stained with ethidium bromide will show2023 · MCQ
  • Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · MCQ
  • Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
  • Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
  • Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ
  • Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · MCQ