NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
Expressed Sequence Tags (ESTs) refers to
- AAll genes that are expressed as proteins.
- BAll genes whether expressed or unexpressed.
- CCertain important expressed genes.
- DAll genes that are expressed as RNA.
View written solutionFree
Correct answer: D
Expressed Sequence Tags (ESTs) are short sub-sequences of a cDNA sequence. They may identify expressed genes, so they are derived from mRNA which is transcribed from expressed genes. They serve as a kind of "tag" or marker for identifying the gene from which it was transcribed. Therefore, ESTs represent genes that are expressed as RNA. The other options listed do not accurately describe what ESTs are.
More from Molecular Basis of Inheritance
- Upon exposure to UV radiation, DNA stained with ethidium bromide will show2023 · MCQ
- Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · MCQ
- Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
- Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ
- Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · MCQ
- Match List-I with List-II: Choose the correct answer from the options given below: Includes table2022 · MCQ
- In lac operon, z gene codes for2022 · MCQ