Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2023 · Q57
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2023 · Q57

Molecular Basis of Inheritance question

2023 · Q57

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Match List I with List II.

List I List II
(A) Gene 'a' (I) β\betaβ-galactosidase
(B) Gene 'y' (II) Transacetylase
(C) Gene 'i' (III) Permease
(D) Gene 'z' (IV) Repressor protein

Choose the correct answer from the options given below :

  1. A
    A-II, B-III, C-IV, D-I
  2. B
    A-III, B-IV, C-I, D-II
  3. C
    A-III, B-I, C-IV, D-II
  4. D
    A-II, B-I, C-IV, D-III
View written solutionFree

Correct answer: A

The question relates to the lac operon model in E. coli, which is a well-studied example of gene regulation. In this model :



- Gene 'z' codes for beta-galactosidase (breaks down lactose into glucose and galactose)

- Gene 'y' codes for permease (transports lactose into the cell)

- Gene 'a' codes for transacetylase (may help in lactose metabolism, but its exact role is unclear)

- Gene 'i' codes for the repressor protein (binds to the operator to prevent transcription)



So, matching the List I (genes) with List II (proteins they code for) :



- A (Gene 'a') matches with II (Transacetylase)

- B (Gene 'y') matches with III (Permease)

- C (Gene 'i') matches with IV (Repressor protein)

- D (Gene 'z') matches with I (Beta-galactosidase)



Therefore, the correct option is :



Option A : A-II, B-III, C-IV, D-I

PreviousNext

More from Molecular Basis of Inheritance

  • Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
  • Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
  • Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ
  • Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · MCQ
  • Match List-I with List-II: Choose the correct answer from the options given below: Includes table2022 · MCQ
  • In lac operon, z gene codes for2022 · MCQ
  • Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?2022 · MCQ
  • If A and C make 30% and 20% of DNA, respectively, what will be the percentage composition of T and G?2022 · MCQ