Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | Gene 'a' | (I) | -galactosidase |
| (B) | Gene 'y' | (II) | Transacetylase |
| (C) | Gene 'i' | (III) | Permease |
| (D) | Gene 'z' | (IV) | Repressor protein |
Choose the correct answer from the options given below :
- AA-II, B-III, C-IV, D-I
- BA-III, B-IV, C-I, D-II
- CA-III, B-I, C-IV, D-II
- DA-II, B-I, C-IV, D-III
View written solutionFree
Correct answer: A
The question relates to the lac operon model in E. coli, which is a well-studied example of gene regulation. In this model :
- Gene 'z' codes for beta-galactosidase (breaks down lactose into glucose and galactose)
- Gene 'y' codes for permease (transports lactose into the cell)
- Gene 'a' codes for transacetylase (may help in lactose metabolism, but its exact role is unclear)
- Gene 'i' codes for the repressor protein (binds to the operator to prevent transcription)
So, matching the List I (genes) with List II (proteins they code for) :
- A (Gene 'a') matches with II (Transacetylase)
- B (Gene 'y') matches with III (Permease)
- C (Gene 'i') matches with IV (Repressor protein)
- D (Gene 'z') matches with I (Beta-galactosidase)
Therefore, the correct option is :
Option A : A-II, B-III, C-IV, D-I
More from Molecular Basis of Inheritance
- Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
- Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ
- Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · MCQ
- Match List-I with List-II: Choose the correct answer from the options given below: Includes table2022 · MCQ
- In lac operon, z gene codes for2022 · MCQ
- Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?2022 · MCQ
- If A and C make 30% and 20% of DNA, respectively, what will be the percentage composition of T and G?2022 · MCQ