Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents

Your guest activity stays on this device

Sign in to save progress →
Sign in

Molecular Basis of Inheritance question

2023 · Q25
Guest · filters and generic practice availableBrowsing as a guest · PYQ filters and generic practice are available. Sign in only for personalised features and saved progress.
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2023 · Q25

Molecular Basis of Inheritance question

2023 · Q25

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

  1. A
    Bright blue colour
  2. B
    Bright yellow colour
  3. C
    Bright orange colour
  4. D
    Bright red colour
View written solutionFree

Correct answer: C

Option (C) is the correct answer because in recombinant DNA technology the separated DNA fragments can be visualised only after staining the DNA with a substance known as ethidium bromide followed by exposure to U.V. radiation. You can see bright orange coloured bands of DNA in an ethidium bromide stained gel exposed to U.V. light.

PreviousNext

More from Molecular Basis of Inheritance

  • Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · MCQ
  • Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
  • Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
  • Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ
  • Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · MCQ
  • Match List-I with List-II: Choose the correct answer from the options given below: Includes table2022 · MCQ
  • In lac operon, z gene codes for2022 · MCQ
  • Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?2022 · MCQ