NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
- ABright blue colour
- BBright yellow colour
- CBright orange colour
- DBright red colour
More from Molecular Basis of Inheritance
- Match List I with List II. Choose the correct answer from the options given below : Includes table2023 · MCQ
- Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around…2023 · MCQ
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?2023 · MCQ
- Given below are two statements Statement I : DNA polymerases catalyse polymerisation only in one direction, that is 5' → 3'. Statement II : During replication of DNA, on one strand the replication is continuous while on other strand it is…2022 · MCQ
- Match List - I with List - II. Choose the correct answer from the options given below Includes table2022 · MCQ
- Match List-I with List-II: Choose the correct answer from the options given below: Includes table2022 · MCQ
- In lac operon, z gene codes for2022 · MCQ
- Against the codon 5' UAC 3', what would be the sequence of anticodon on tRNA?2022 · MCQ