Doubts
Sign in
12thPass logo
New chatPYQ LibraryDoubtsRank report
Sign in to see Recents
Sign in to save progress →
Doubts
Sign in

Molecular Basis of Inheritance question

2024 · Q48
Guest · try one question or challengeGuest · try one question or challenge
  1. PYQ Library
  2. /NEET
  3. /Biology
  4. /Molecular Basis of Inheritance
  5. /2024 · Q48

Molecular Basis of Inheritance question

2024 · Q48

NEETBiologyMolecular Basis of InheritanceMCQ+4 / −1

Match List I with List II

List - I List - II
A. Frederick Griffith I. Genetic code
B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana III. Tranformation
D. Meselson & Stahl IV. Lac operon

Choose the correct answer from the options given below:

  1. A
    A-III, B-II, C-I, D-IV
  2. B
    A-III, B-IV, C-I, D-II
  3. C
    A-II, B-III, C-IV, D-I
  4. D
    A-IV, B-II, C-II, D-III
PreviousNext

More from Molecular Basis of Inheritance

  • Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
  • Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ
  • Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · MCQ
  • Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have…2024 · MCQ
  • In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:2024 · MCQ
  • Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose…2024 · MCQ
  • Given below are two statements : Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense. Statement II : RNAi involves the silencing of a specific mRNA due to a complementary single-stranded RNA…2024 · MCQ