Match List I with List II
| List - I | List - II | ||
|---|---|---|---|
| A. | Frederick Griffith | I. | Genetic code |
| B. | Francois Jacob & Jacque Monod | II. | Semi-conservative mode of DNA replication |
| C. | Har Gobind Khorana | III. | Tranformation |
| D. | Meselson & Stahl | IV. | Lac operon |
Choose the correct answer from the options given below:
- AA-III, B-II, C-I, D-IV
- BA-III, B-IV, C-I, D-II
- CA-II, B-III, C-IV, D-I
- DA-IV, B-II, C-II, D-III
View written solutionFree
Correct answer: B
To solve this matching question, let's discuss each scientist(s) and their contribution:
A. Frederick Griffith: Known for discovering the "transforming principle," which showed that a substance from dead bacteria could genetically transform living bacteria. This process is called transformation. The correct match for Frederick Griffith is III. Transformation.
B. Francois Jacob & Jacques Monod: They are famous for their work on the lac operon, a set of genes involved in lactose metabolism in bacteria. Their study elucidated how genes are regulated and expressed in cells. The correct match for Francois Jacob and Jacques Monod is IV. Lac operon.
C. Har Gobind Khorana: Known for his research on the genetic code and its role in protein synthesis. Khorana was one of the scientists who elucidated how the sequence of nucleotides in nucleic acids is translated into protein sequences. The correct match for Har Gobind Khorana is I. Genetic code.
D. Meselson & Stahl: Famous for their experiment confirming the semi-conservative mechanism of DNA replication, where each new DNA molecule consists of one old strand and one newly synthesized strand. The correct match for Meselson and Stahl is II. Semi-conservative mode of DNA replication.
Comparing this information with the options provided:
- Option A: A-III, B-II, C-I, D-IV (Incorrect: B does not match II)
- Option B: A-III, B-IV, C-I, D-II (Correct: All matches are accurate)
- Option C: A-II, B-III, C-IV, D-I (Incorrect: A, B, C, and D do not match correctly)
- Option D: A-IV, B-II, C-II, D-III (Incorrect: A, C, and D do not match correctly)
Therefore, the correct answer is Option B.
More from Molecular Basis of Inheritance
- Match List I with List II : Choose the correct answer from the options given below : Includes table2024 · MCQ
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'2024 · MCQ
- Match List I with List II: Choose the correct answer from the options given below : Includes table2024 · MCQ
- Given below are two statements regarding RNA polymerase in prokaryotes. Statement I : In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. Statement II : RNA polymerase associate…2024 · MCQ
- Given below are two statements: Statement I: In eukaryotes there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelles. Statement II: All the three RNA polymerases in eukaryotic nucleus have…2024 · MCQ
- In a chromosome, there is a specific DNA sequence, responsible for initiating replication. It is called as:2024 · MCQ
- Given below are two statements : Statement I: In the lac operon, the z gene codes for beta-galactosidase which is primarily responsible for the hydrolysis of lactose into galactose and glucose. Statement II: In addition to lactose, glucose…2024 · MCQ
- Given below are two statements : Statement I : RNA interference takes place in all Eukaryotic organisms as method of cellular defense. Statement II : RNAi involves the silencing of a specific mRNA due to a complementary single-stranded RNA…2024 · MCQ